Categories: Uncategorized

answer the question 353

The DNA was isolated from the following an unknown organism, PCR was performed to amplify the DNA, it was then sent for sequencing.
The following is the sequence that was obtained, similar to the protocol for the Bacterial ID: Use the sequence to identify the most likely organism using the nucleotide BLAST function of the the NCBI.
Note: Copy the sequence onto a Word Pad or similar text file format when entering in the NCBI databases. Keep all other parameters at default position. Write the genus and species of the organisms from the BLAST results
>Unknown Sequence A
tctctgatgt tagcggcgga cgggtgagta acacgtggat aacctaccta taagactgggataacttcgg gaaaccggag ctaataccgg ataatatttt gaaccgcatg gttcaaaagtgaaagacggt cttgctgtca cttatagatg gatccgcgct gcattagcta gttggtaaggtaacggctta ccaaggcaac gatgcatagc cgacctgaga gggtgatcgg ccacactggaactgagacac ggtccagact cctacgggag gcagcagtag ggaatcttcc gcaatgggcgaaagcctgac ggagcaacgc cgcgtgagtg atgaaggtct tcggatcgta aaactctgttattagggaag aacatatgtg taagtaactg tgcacatctt gacggtacct aatcagaaagccacggctaa ctacgtgcca gcagccgcgg taatacgtag gtggcaagcg ttatccggaattattgggcg taaagcgcgc gtaggcggtt ttttaagtct gatgtgaaag cccacggctcaaccgtggag ggtcattgga aactggaaaa cttgagtgca gaagaggaaa gtggaattccatgtgtagcg gttaaatgcg cagagatatg gaggaacacc agtggcgaag gcgactttctggtctgtaac tgacgctgat gtgcgaaagc gtgggaatca aacaggatta gataccctggtagtccacgc cgtaaacgat gagtgctaag tgttaggggg tttccgcccc ttagtgctgcagctaacgca ttaagcactc cgcctgggga gtacgaccgc aaggttgaaa ctcaaaggaattgacgggga cccgcacaag cggtggagca tgtggtttaa ttcgaagcaa cgcgaagaaccttaccaaat cttgacatcc tttgacaact ctagagatag agccttcccc ttcgggggacaaagtgacag gtggtgcatg gttgtcgtca gctcgtgtcg tgagatgttg ggttaagtcccgcaacgagc gcaaccctta agcttagttg ccatcattaa gttgggcact ctaagttgactgccggtgac aaaccggagg aaggtgggga tgacgtcaaa tcatcatgcc ccttatgatttgggctacac acgtgctaca atggacaata caaagggcag cgaaaccgcg aggtcaagcaaatcccataa agttgttctc agttcggatt gtagtctgca actcgactac atgaagctggaatcgctagt aatcgtagat cagcatgcta cggtgaatac gttcccgggt cttgtacacaccgcccgtca caccacgaga gtttgtaaca
 
Do you need a similar assignment done for you from scratch? We have qualified writers to help you. We assure you an A+ quality paper that is free from plagiarism. Order now for an Amazing Discount! Use Discount Code “Newclient” for a 15% Discount!NB: We do not resell papers. Upon ordering, we do an original paper exclusively for you.

The post answer the question 353 appeared first on Superb Professors.

"Order a Custom Paper on Similar Assignment! No Plagiarism! Enjoy 20% Discount"

Superbprofessors

Recent Posts

case study one page case study one page case study one page case study one page case study one page

Case study one page Case study one page Case study one page Case study one…

2 years ago

business calculus quiz

Business Calculus quiz that is 10 questions and has an hour time limit. Must be…

2 years ago

hnif 355 disscussion post

Write a 175- to 265-word response to the following: What constitutes “robust interoperability,” and what…

2 years ago

news briefing quest 2

For this News Briefing Quest task , pick and analyze a U.S. political news article…

2 years ago

acc610 final project milestone two critical element ii analysis of financial statements

ACC 610 Milestone TwoGuidelines and Rubric This is the secondof three milestone assignments that will…

2 years ago

write in complete paragraphs 5 pages

Please answer the questions in the attachment. I have sent you the required materials. Send…

2 years ago